太阳成集团tyc522cc

 
Toll-free:400-690-0195 English 中文版
   
miRNA Inhibitor
GenePharma miRNA inhibitors are chemically-modified and optimized nucleic acids designed to specifically target the microRNA (miRNA) molecules in cells. Endogenous microRNAs are small
 

Store at or below –20°C.
Do not store in a frost-free freezer.

Product Description:
A single-stranded RNA oligonucleotide designed for use in miRNA function research.

Appearance: Powder

Product Inhibitors:
Sanger miRNA Registry ID#:
For example: hsa-miR-1
Mature miRNA Sequence: UGGAAUGUAAAGAAGUAUGUA
Inhibitor Sequence: UACAUACUUCUUUACAUUCCA

Storage Conditions:
Store at or below –20°C. Do not store in a frost-free freezer. (Dried oligonucleotides are shipped at ambient temperatures.)

 

General Information:
GenePharma miRNA Inhibitors are designed to inhibit the activity of endogenous miRNAs when introduced into cells. These RNA-based inhibitors are chemically modified to increase their stability.
GenePharma miRNA Inhibitors can be delivered to mammalian cells by chemical transfection or electroporation.

 

Handling Instructions:
RNA oligonucleotides are susceptible to degradation by exogenous ribonucleases introduced during handling. Wear gloves when handling this product. Use RNase-free reagents, tubes, and barrier pipette tips. Upon receipt, store in a non-frost-free freezer, at or below –20°C.

 

Resuspension Instructions:
Briefly centrifuge the tube to ensure that the dried oligonucleotides are at the bottom of the tube. Resuspend the oligonucleotides at a convenient concentration. To minimize freeze-thaw cycles, we recommend preparing a concentrated stock, such as 20 μM, and then further diluting to a practical working stock concentration. (Resuspend 5 nmol of oligonucleotide in 250 μL of Nuclease-free Water to obtain a 20 μM solution.)

 

Applications:
miRNA Inhibitors are designed for use in miRNA experiments and cell cultures to intervene miRNA-mediated gene silencing. For this application, a miRNA Inhibitor is introduced into cells that express the corresponding miRNA, and the expression of the endogenous target of the corresponding miRNA, or of a reporter construct containing the predicted target miRNA binding site is measured.

 

Expression of Endogenous miRNA Targets:
To analyze the effects that miRNAs have on an endogenous target, miRNA Inhibitors can be transfected into cells to evaluate whether the endogenous mRNA target expression is reversed in protein level.

 

Expression of miRNA Target Reporter Plasmid
Reporter plasmids, with one or several miRNA binding sites in the 3’ UTR of the reporter gene, are commonly used to evaluate the direct interaction between miRNA-potential miRNA targets. When co-transfected with a reporter plasmid containing corresponding miRNA binding sites, a miRNA Inhibitor can relieve the inhibition of gene expression caused by an endogenous miRNA. This type of experiment typically also includes a second reporter plasmid to normalize for transfection variation.

We recommend transfection with nontargeting miRNA inhibitor negative control as a baseline reference. Nontargeting miRNA inhibitor negative control should be used at the same concentration as experimental target miRNA inhibitor, because nucleic acid concentrations within cells can affect the activity and specificity of miRNAs.

 

Transfection Starting Points for Mammalian Cells
As with other small nucleic acids, such as siRNAs and antisense oligonucleotides, the efficiency with which mammalian cells are transfected with miRNA inhibitors will vary according to cell type and the transfection reagent used. The optimal concentration used for transfections should be determined empirically.

 
Description
Experimental
Usage
Application
Ordering
Support-Publication

 

1